Skip to main content
Download PDF

Cyclic-di-AMP confers an invasive phenotype on Escherichia coli through elongation of flagellin filaments

Gut Pathogens volume 16, Article number: 6 (2024) Cite this article

Abstract

Background

Adherent-invasive Escherichia coli (AIEC) is isolated from patients with Crohn’s disease (CD). AIEC can invade the intestinal epithelium, suggesting that it is involved in the development and pathogenesis of CD. However, the mechanism by which AIEC acquired the invasive phenotype remains unknown.

Results

This study was designed to examine the mechanisms of AIEC invasiveness. We found that the flagellin (fliC) expression in AIEC was two-fold higher than that in non-AIEC strains, and this overexpression induced the formation of long-filament flagellin. Deletion of fliC in the AIEC LF82 strain resulted in the disappearance of flagellar filaments and attenuated the motility and invasive ability of the bacterium, suggesting that the formation of long filament flagellin induced by increased fliC expression is required by AIEC to invade the intestinal epithelium. In AIEC and non-AIEC K12 strains cultured in the presence of cyclic-di-AMP (c-di-AMP), the expression of fliC was enhanced, and flagellar filaments were elongated. Stimulation with c-di-AMP enhanced the bacterial motility and ability to invade epithelial cells, even in the non-AIEC K12 strain.

Conclusions

Our findings show that c-di-AMP confers an AIEC-like phenotype on non-AIEC strains by enhancing the expression of fliC. The results should be useful for understanding the pathogenesis of CD.

Background

Crohn’s disease (CD) is an inflammatory bowel disease (IBD), with courses of ulceration, inflammation, and fibrosis in the intestine and digestive tract. CD is an intractable disease of unknown etiology that is more common among young people. The incidence of IBD is increasing worldwide, particularly in the developed countries [1, 2]. From several previous studies have shown alterations in the gut microbiota of patients with CD compared to healthy subjects, suggesting that dysbiosis of the gut microbiota is associated with the development and pathogenesis of CD [3, 4].

Commensal gut bacteria communicate with each other to coordinate their behavior and function. Bacterial communication is achieved by modifying gene expression using second messengers. Cyclic di-AMP (c-di-AMP), a cyclic nucleotide produced by bacteria, is a second messenger that regulates bacterial gene expression by binding to its target effectors.

Adherent-invasive Escherichia coli (AIEC) have been isolated from the distal end of the ileum, a common stricture site in patients with CD [5]. Unlike non-AIECs, AIECs adhere and invade the intestinal epithelium. The adhesion of AIEC is mediated by interactions between bacterial type-1 pili and carcinoembryonic antigen-related adhesion molecule 6 (CECAM6) on the surface of the host epithelium [6]. The bacterial invasion is promoted by the binding of bacterial outer membrane proteins (OmpA) to the ER-stress response chaperone, Gp96, which is strongly expressed on the apical surface of ileal epithelial cells [7, 8]. The specific adhesion and invasiveness of AIEC are believed to strongly contribute to the development and pathogenesis of CD, especially the postoperative recurrence [9].

The flagellum of E. coli is a complex structure consisting of three main structural regions: the basal body, hook, and filament. The flagellin filament extends outward from the basal body and is a polymer of the flagellin subunits encoded by fliC. Flagellin filaments are responsible for the ability of AIEC strains to cross the mucus layer in vitro and in vivo and reach the epithelial surface [10].

We recently showed that AIEC-specific IgA antibodies are produced in the gastrointestinal tract of AIEC-infected mice. The IgA antibody specific to AIEC could inhibit its ability to adhere to and invade the intestinal epithelial Caco-2 cells [11]. However, it remains unclear how AIEC acquired the ability to adhere to and invade the intestinal epithelium. The present study was aimed at elucidating the acquisition mechanisms of adhesion and invasiveness of AIEC. The results implicate the role of flagellin elongation in E. coli mediated through c-di-AMP in the invasive ability of AIEC. The results of this study should help better understand the pathogenesis of CD and aid in devising better therapeutic strategies against this intractable disease.

Results

Flagellar filaments of AIEC are elongated as a result of increased fliC expression.

Bacterial flagella mediate not only motility but also bacterial adhesion and invasion [12, 13]. We compared the flagellar structure in the AIEC LF82 strain isolated from patients with CD with that of E. coli K12 strain as a non-AIEC reference strain. The flagellar length of the AIEC LF82 strain was significantly greater than that of the non-AIEC K12 strain (Fig. 1a, b). The flagellar structure in E. coli contains three distinct components: a basal body, hook, and extracellular filament. The flagellin (FliC) subunit is the main component of the flagellar structure [14]. To clarify the involvement of FliC in flagellar elongation in the AIEC LF82 strain, fliC deletion mutants (ΔfliC strains) were constructed using homologous recombination (Additional file 1: Fig. S1a). We confirmed the deletion of fliC gene (1489 bp) using polymerase chain reaction (PCR) (Additional file 1: Fig. S1b). The flagellar filaments of both the AIEC LF82 and non-AIEC K12 strains completely disappeared after fliC deletion (Fig. 1a). We then compared the expression levels of fliC mRNA in AIEC LF82 with those in the non-AIEC K12 strain. fliC expression levels in the AIEC LF82 strain were significantly higher than those in the non-AIEC K-12 strains (Fig. 1c). Additionally, the levels of fliC mRNA expression were enhanced in several AIEC strains compared with those in several non-AIEC strains, which indicates that increased fliC expression inducing flagellar elongation is a characteristic of the AIEC strain (Fig. 1d).

Fig. 1
figure 1

Flagellin in the AIEC strains is elongated depending on the increase in fliC expression. A Morphological changes in non-AIEC K12 and AIEC LF82 strains were visualized using SEM. Each image represents a different bacterial area. Scale bar = 1.0 μm. B Flagellin length per bacterial cell was measured using the ImageJ software. *P < 0.05; P-values were determined using the unpaired Student’s t-test. C Comparison of fliC mRNA expression levels between AIEC and non-AIEC strains clinically isolated from patients with Crohn’s Disease (CD) was performed using quantitative real-time RT-PCR. Data are presented as the mean ± SD. *P < 0.05; P-values were determined using the unpaired Student’s t-test. (n = 10 strains each). D Comparison of fliC mRNA expression levels between the AIEC LF82 and non-AIEC K12 strains. Data are presented as the mean ± SD. *P < 0.05; P-values were determined using the unpaired Student’s t-test. (n = 3 for each strain)

Full size image

Enhanced bacterial migration and invasive abilities of AIEC are provided by increased fliC expression.

To examine whether the migration ability of the AIEC LF82 strain was enhanced, the swimming motility of the bacterium was measured using Luria Bertani (LB) medium containing 0.3% agar [9]. The swimming diameters of the AIEC LF82 strain were significantly greater than those of the non-AIEC K12 strain (Fig. 2a, b). The enhanced swimming ability of the AIEC LF82 strain was significantly attenuated to the same level as that of the non-AIEC K12 strains by deletion of fliC (Fig. 2b). Next, we constructed in vitro bacterial infection models using Caco-2 cells grown on Transwell inserts to evaluate the bacterial invasion ability (Fig. 2c). Caco-2 cells grown on Transwell inserts were infected with each bacterium (1 × 105 bacteria) for 3 h and then incubated for 3 h with Dulbecco's modified Eagle medium (DMEM) containing kanamycin to kill extracellular bacteria. The number of bacteria within Caco-2 cells infected with the AIEC LF82 strain was significantly higher than that in cells infected with the non-AIEC K12 strain (Fig. 2d). The fliC deletion significantly decreased the number of invading bacteria in both non-AIEC K12 and AIEC LF82 strains and attenuated the enhanced invasive ability of the AIEC LF82 strain compared with that of the non-AIEC K12 strain (Fig. 2d). Additionally, in AIEC LF82-infected mice, the number of invasive bacteria in the cecal epithelium was decreased by deletion of fliC (Fig. 2e). Together, our results show that the bacterial migration and invasion abilities of the AIEC LF82 strain were enhanced by the increased fliC expression.

Fig. 2
figure 2

Migration and invasive abilities of the AIEC LF82 strain are promoted depending on the increase in fliC expression. A Representative images of the bacterial growth zones (swimming diameters) for non-AIEC K12 and AIEC LF82 strains. Each bacterial strain (OD570 = 1.0) was added to the center of a plate containing Luria Bertani (LB) medium containing 0.3% agar and incubated at 37 °C for 16 h. B Bacterial swimming diameters on LB agar plates were measured using the ImageJ software. Data are presented as mean ± SD. *P < 0.05, **P < 0.01; P-values were determined using the student’s t-test. C In vitro infection model using Transwell inserts. Caco-2 cells grown on the insert were incubated with the bacteria at a multiplicity of infection (MOI) of 1:100 (1 × 105 bacteria/well) for 30 min. Caco-2 cells grown on the inserts were incubated with the bacteria for 3 h and then washed and incubated for 3 h in Dulbecco’s modified Eagle medium (DMEM) containing 400 μg/mL kanamycin to kill extracellular bacteria. D Caco-2 cells were lysed with PBS containing 1% Triton X-100, and the lysates were plated on LB agar. Colony-forming units (CFU) were counted after 24 h of incubation. Data are presented as the mean ± SD. *P < 0.05, **P < 0.01; P-values were determined using the student’s t-test. E Bacterial counts in the colon were determined five days after infection. Mice were administered antibiotics (20 mg/L streptomycin and 1 g/L ampicillin) for 9 days and then orally inoculated with 1 × 10.9 CFU of LF82 and ΔfliC-LF82. The colon tissue was homogenized in PBS, and the homogenates were plated onto MacConkey agar containing 50 μg/mL ampicillin. The number of CFU was counted. Data are presented as mean ± SD (n = 5 per group)

Full size image

c-di-AMP elongates flagella in both non-AIEC K12 and AIEC LF82 strains by enhancing fliC expression.

c-di-AMP is a bacterial second messenger that regulates the expression of several genes involved in DNA damage, biofilm formation, acid stress resistance, and other functions [15,16,17,18,19]. We hypothesized that the expression of fliC in E. coli is enhanced by c-di-AMP signaling. To test this hypothesis, we examined changes in fliC expression and flagellar elongation in the presence of c-di-AMP. The expression of fliC in both non-AIEC K12 and AIEC LF82 strains increased 2- and fourfold, respectively, in the presence of 5.0 μM c-di-AMP (Fig. 3a). Next, we examined the flagellar length in each bacterium cultured in the presence of c-di-AMP using scanning electron microscopy (SEM) and transmission electron microscopy (TEM). Additionally, we calculated the flagellar length using SEM analysis data, because SEM can efficiently image the whole bacterial structure and has been used for observations of the bacterial cell surface contaminations and biofilm structure [20, 21]. The results showed that, in the presence of c-di-AMP, the flagellar length is increased in both non-AIEC K12 and AIEC LF82 strains (Fig. 3b, c). In fliC-deletion mutant strains, elongated flagellar structures were not observed even in the presence of c-di-AMP (Fig. 3b).

Fig. 3
figure 3

C-di-AMP enhances the expression of fliC and elongates the flagellin in both non-AIEC K12 and AIEC LF82 strains. A The expression levels of fliC in the non-AIEC K12 and AIEC LF82 strains, which were cultured in the presence of 5.0 μM c-di-AMP for 16 h, were analyzed using quantitative real-time PCR. Data are presented as the mean ± SD. *P < 0.05, **P < 0.01; P-values were determined using the unpaired Student’s t-test. (n = 4 each). B Morphological changes in non-AIEC K12 and AIEC LF82 strains cultured in the presence of 5.0 μM c-di-AMP for 16 h were visualized using scanning electron microscopy (SEM). Each image is representative of different bacterial areas (n = 4 each). C Length of flagellin filaments measured using SEM images. SEM images were imported into the ImageJ software, and the flagellin length per bacterial cell was measured. Data are presented as the mean ± SD. *P < 0.05; P-values were determined using the student’s t-test. Scale bar = 2.0 μm

Full size image

c-di-AMP confers an AIEC-like phenotype to non-AIEC strains by enhancing fliC expression.

We examined whether the flagellar elongation induced by c-di-AMP affected bacterial migration and invasion. The swimming diameters of both the non-AIEC K12 and AIEC LF82 strains were significantly extended in the presence of c-di-AMP, but not in the fliC-deletion mutant strain (Fig. 4a, b). Additionally, the numbers of intracellular bacteria within Caco-2 cells infected with the non-AIEC K12 and AIEC LF82 strains were significantly increased in the presence of c-di-AMP (Fig. 4c). In contrast, in fliC-deletion mutant strain-infected Caco-2 cells, c-di-AMP stimulation did not increase the number of intracellular bacteria (Fig. 4c). These findings suggest that c-di-AMP enhances bacterial motility and invasiveness through the elongation of flagella by increasing the expression of fliC (Fig. 4c).

Fig. 4
figure 4

C-di-AMP enhances migration and invasion abilities of both non-AIEC K12 and AIEC LF82 strains. A Representative images of the bacterial growth zone (swimming diameters) of the non-AIEC K12 and AIEC LF82 strains in the presence of 5.0 μM c-di-AMP. Each bacterial strain (OD570 = 1.0) was added to the center of a plate containing Luria Bertani (LB) medium containing 0.3% agar and 5.0 μM c-di-AMP, and then the plate was incubated at 37 °C for 16 h. B Bacterial swimming diameters on LB agar plates were measured using the ImageJ software. Data are presented as mean ± SD. *P < 0.05, **P < 0.01; P-values were determined using the student’s t-test. C Each bacterial strain was precultured in LB broth containing 5.0 μM c-di-AMP for 16 h, and then added to Caco2 cells at a multiplicity of infection (MOI) of 1:100 (1 × 105 bacteria/well). After 3 h incubation, each bacterial strain was added to Caco-2 cells (MOI of 1:100 (1 × 10.5 bacteria/well) for 3 h and incubated for 3 h in DMEM containing 400 μg/mL kanamycin to kill extracellular bacteria. The Caco2 cells were lysed with PBS containing 1% Triton X-100, and the lysates were plated on LB agar. Colony-forming units (CFU) were counted after 24 h of incubation. Data are presented as the mean ± SD. **P < 0.01; P-values were determined using the student’s t-test. (n = 3)

Full size image

c-di-AMP is synthesized and secreted by several types of bacteria, mainly gram-positive bacteria [19]. We hypothesized that intracellular c-di-AMP synthesis is specifically enhanced in the AIEC strain compared with that in the non-AIEC strains. To prove this, we measured the c-di-AMP concentration within bacterial cells through liquid chromatography-tandem mass spectrometry. However, intracellular c-di-AMP was not detected in either the AIEC or non-AIEC strains, suggesting that c-di-AMP is not synthesized even in AIEC strain (Additional file 1: Fig. S2a). This may be because E. coli, which belongs to the class Deltaproteobacteria does not encode the diadenylate cyclase domain, which converts two ATP or ADP molecules into one c-di-AMP molecule [19, 22]. From these observations, we can assume that E. coli accepts extracellular c-di-AMP produced by other gut microbial communities.

Discussion

AIEC strains are capable of adhering to and invading the intestinal epithelium, unlike the intestinal commensal E. coli [23]. Although AIEC strains are thought to contribute to the development of CD, the origin and/or route of infection is not well known. Alterations in the composition of the gut microbiota in patients with CD compared with that in healthy donors has been reported [24]. Imbalances in the gut microbiota affect the overall structure of the microbiota community and specific bacterial expansion by altering bacterial cell–cell communication [25]. In the present study, we examined whether c-di-AMP, a bacterial cell–cell communication messenger, affects the E. coli phenotype associated with invasion of the host epithelium. The results showed that c-di-AMP enhanced the motility of bacteria and their ability to invade epithelial cells, in both AIEC non-AIEC strains, by elongating the bacterial flagellum. Our findings suggest that c-di-AMP confers an AIEC-like phenotype on non-AIEC strains in the gut lumen.

Genes involved in the flagellar assembly are classified into three groups: classes I–III [26]. Class III genes are involved in fiber formation, the final step in flagellar development (including flagellar fiber-forming flagellin), and in the functioning of the completed flagellum [26]. The fliC genes belonging to class III encode flagellin, which forms flagellar fibers. Genes belonging to class III are downstream of class II genes; therefore, the expression of class III genes is regulated by class II promoters. Flagella are involved in the ability of AIEC to cross the mucus layer; therefore, enhancement of bacterial motility by the flagellar function is believed to confer a selective advantage to E. coli in penetrating the mucus layer and reaching the epithelial surface [23]. In AIEC infection models in vivo, the deletion of fliC decreased bacterial adhesion to the intestinal epithelium (Fig. 2e). Additionally, the deletion of fliC significantly decreased bacterial motility in both the AIEC and non-AIEC strains (Fig. 2a, b). These findings suggest that the acquisition of enhanced bacterial motility by increasing the expression of fliC hastens the approach of the bacteria to the epithelial surface, leading to enhanced adherence and invasiveness. The results showed that the fliC expression levels regulate the length of flagellar filaments, contributing to bacterial invasiveness.

In the present study, we showed that c-di-AMP enhances the flagellin expression, motility and invasiveness of E. coli, supported by the analysis of both non-AIEC K12 and AIEC LF82 strains. To date, as shown in Fig. 1d, several AIEC and non-AIEC strains have been clinically isolated from patients with CD. However, the whole genome information of these clinically isolated strains has not been published. Therefore, it is not possible to construct a fliC-deletion mutant strain, and the genetic diversity of each strain involved in c-di-AMP responses is difficult to understand. AIEC LF82 has been isolated from patients with CD and is the representative strain of AIEC [27]. The non-AIEC K12 strain has been used in many experiments as the representative strain of E. coli [28, 29]. The whole genome sequences are available for both of these strains (K12 strain: NCBI Reference Sequence: U00096.3, LF82 strain NCBI Reference Sequence: NC_011993.1). Therefore, we could construct the fliC-deletion mutant strains. Given the reasons we explain above, increasing the number of bacterial strains for analysis is difficult, and this was an experimental limitation of our study. Although the present study showed that the c-di-AMP conferred AIEC-like phenotypes to non-AIEC strains by enhancing flagellin expression, motility and invasiveness, as well as elongating flagellum, further studies that include larger sample size of clinically isolated non-AIEC and AIEC strains are needed.

As evident from Additional file 1: Figure S2, neither the AIEC nor the K12 strain synthesizes c-di-AMP, and thus we speculate that extracellular c-di-AMP released by other gut microbiota communities is sensed and utilized. The composition of the gut microbiota is known to be altered in patients with CD compared with that in healthy donors; therefore, we assume that the gut microbial composition is enriched with microorganisms possessing high c-di-AMP production abilities in patients with CD. Interestingly, several gram-positive bacteria have been identified as high c-di-AMP producers and a relatively high proportion of gram-positive bacteria has also been reported in the gut microbiota of patients with IBD [30, 31]. Hence, the production of c-di-AMP in the gastrointestinal lumen of patients with IBD may be elevated. Although further studies are needed to identify the gut microbiota communities that enhance c-di-AMP levels in patients with CD, our findings reveal that extracellular stimulation of c-di-AMP in the gut lumen induces the expression of fliC and confers the invasiveness of E. coli.

Conclusion

AIEC isolated from patients with CD have the ability to adhere and invade the intestinal epithelium and are involved in the development and recurrence of CD. However, it remains unknown how exactly AIEC acquire these abilities. The aim of this study was to examine the acquisition mechanism of adhesion and invasiveness in E. coli. Here, we show that flagellin gene expression in clinically isolated AIEC strains is increased by two-fold compared to that of non-AIEC strains, and the deletion of fliC in AIEC strains attenuates bacterial motility and adhesion ability. The expression of fliC in non-AIEC strains was increased by treatment with cyclic-di-AMP, resulting in the formation of long-filament flagellin. Furthermore, stimulation by cyclic-di-AMP enhanced bacterial motility and the ability to adhere to epithelial cells in the non-AIEC strain. Our findings demonstrated that cyclic-di-AMP confers an AIEC-like phenotype to non-AIEC strains via the enhancement of fliC expression.

Methods

Ethics for human studies

The study design was reviewed and approved by the Institutional Review Board of Tokai University School of Medicine (No. 20I-35) and was conducted according to principles of the Declaration of Helsinki. Written informed consent was obtained from all participants before their inclusion in the study.

Ethics for animal studies

Animal experiments were approved by the Tokai University (Kanagawa, Japan) Animal Research Committee (No. 220244) and were conducted in accordance with the “Act on Welfare and Management of Animals of Japan,” “Standards relating to the Care and Keeping and Reducing Pain of Laboratory Animals,” “Standards relating to the Methods of Destruction of Animals,” “Guidelines for Proper Conduct of Animal Experiments,” and “Fundamental Guidelines for Proper Conduct of Animal Experiments.”

Bacterial strains and cell lines

Escherichia coli K12 ATCC10798, purchased from the American Type Culture Collection (ATCC), was used as the non-AIEC strain. E. coli LF82 strain was isolated from a chronic ileal lesion in a patient with CD and used as the AIEC strain [32]. The following clinical isolates of E. coli were used in this study: E. coli HS, LF1, LF6, LF19, LF48, LF55, LF111, LF134, LF135, LF82, LF16, LF31, LF73, 6076, 6088, 6170, 6254, 6259, and 6283 [33, 34]. All bacteria were routinely cultured in LB broth (Nacalai Tesque Inc., Japan) overnight at 37 °C with shaking at 160 rpm until their growth reached the mid-exponential phase (OD570 = 1.0).

Human colon adenocarcinoma, Caco-2, cells were purchased from the European Collection of Cell Cultures (ECACC 86010202). Caco-2 cells were maintained in a 5% CO2 atmosphere at 37 °C in DMEM (Gibco), supplemented with 10% (v/v) fetal bovine serum (Gibco), 0.01% minimum essential medium non-essential amino acids solution (Invitrogen), 0.01% L-glutamine (Invitrogen), and 0.01% penicillin–streptomycin (Nacalai Tesque Inc.).

Construction of fliC deletion mutant

The target-region gene cassette (5′fliC–ampicillin resistance gene–3′fliC) for construction of a fliC-deletion mutant was cloned into a temperature sensitive pTSC30 plasmid [35]. The cassette was inserted into the open reading frame of fliC. The target-region gene cassette was constructed using the PCR-based overlap extension method. The primer sequences used for the construction of the cassette were as follows: 5′flic region: forward 5′-CTCGAGCATGGCACAAGTCAT and reverse 5′-CGACACGGAAATGTTGAATACTCATAATTTCGTCCTGGATAGAAGACAG; ampicillin resistance gene region: forward 5′-CTGTCTTCTATCCAGGACGAAATTATGAGTATTCAACATTTCCGTGTCG and reverse 5′-CTACAGATGCGATAGCATCGTCCAGACCAATGCTTAATCAGTGAGGCAC; 3′flic region: forward 5′-GTGCCTCACTGATTAAGCATTGGTCTGGACGATGCTATCGCATCTGTAG and reverse 5′-GGATCCTTAACCCTGCAGCA. For overlap extension, the forward primer used was the 5′flic region forward primer and the reverse primer was the 3′flic region reverse primer. The target-region gene cassette was inserted into the pTSC30 plasmid using the XhoI and BamHI sites and NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs). The target pTSC30 plasmid was electroporated into E. coli K12 cells, which were cultured overnight and selected on LB agar containing 50 μg/mL ampicillin at 37 °C. The AIEC LF82 fliC deletion mutant strain (AIEC LF82 ΔfliC) was a gift from Dr. Nobuhiko Kamada (Department of Pathology and Comprehensive Cancer Center, University of Michigan, USA) [36].

In vivo bacterial infection

All animal experiments were approved by the Tokai University (Kanagawa, Japan) Animal Research Committee (No. 220244). Seven- to eight-week-old C57BL/6 J female mice were purchased from CLEA Japan Co., Ltd. The mice were provided drinking water containing 20 mg/L streptomycin and 1 g/L ampicillin for 1 week prior to bacterial infection. They were orally inoculated with 200 μL LB broth containing AIEC LF82 or LF82-ΔfliC (1 × 109 bacteria) using a stainless-steel feeding needle fitted to a 1.0 mL syringe and sacrificed 5 days after infection. The colorectal tissue was harvested and homogenized using a Biomasher II (Nippi, Japan). Serial dilutions of the homogenates were plated on LB agar, and colony-forming units (CFUs) were counted after 24 h of incubation.

In vitro bacterial infection

Caco-2 cells (2 × 105 cells/well) were seeded in each well of 6-well Transwell insert culture plates (0.4 µm pore size) (Corning, Lowell) at day 7. Bacteria were precultured overnight with or without 5.0 µM c-di-AMP (Sigma) in LB broth. Caco-2 cells were infected with each bacterial strain (1 × 105 bacteria) at a multiplicity of infection of 0.5 for 3 h and then incubated with DMEM containing kanamycin for 3 h to kill extracellular bacteria. The cells were lysed with PBS containing 1% Triton X-100 and the lysates were plated on LB agar. The number of CFUs was counted after 24 h incubation at 37 °C.

Extraction of total RNA and quantitative real-time RT-PCR

AIEC and non-AIEC strains were preincubated overnight with or without 5 µM c-di-AMP (Sigma). Total RNA was isolated from bacteria using the SV Total RNA Isolation Kit (Promega) according to the manufacturer’s guidelines. The extracted total RNA was reverse-transcribed into single-stranded cDNA using the PrimeScript™ RT reagent kit (Takara). PCR was performed using the StepOne™ Real-Time PCR system with PowerTrack™ SYBR Green Master Mix (Thermo Fisher Scientific). The sequences of primers were as follows: non-AIEC: F: 5′-ATTCCGTTCTTCCCTCGGTG-3′, R: 5′-TGGACACTTCGGTCGCATAG-3′ (amplicon size: 131 bp) and F: 5′-ATGGCACAAGTCATTAATACC-3′, R: 5′-AAGACAGACGCTCGATAGAAC-3′ (amplicon size: 100 bp); AIEC: F: 5′-TGGTGCTGCAACTGCTAACGC-3′, R: 5′-TTATCGGCATATTTTGCGCTAGC-3′ (amplicon size: 212 bp) and F: 5′-CGGCAAATACCGCCTGATACG-3′, R: 5′-GCTACAGCTAAACAAGGCACA-3′ (amplicon size: 100 bp). Relative gene expression levels were measured using the 2nd Derivative Maximum method. The 16 s rRNA gene was used as a quantitative loading control and was amplified using the following primers: F: 5′-CATGCCGCGTGTATGAAGAA-3′ and R: 5′-CGGGTAACGTCAATGAGCAAA-3′.

Swimming motility assay

Bacterial swimming motility was evaluated in LB broth containing 0.3% agar (Becton Dickinson) and 0.3% glucose (Nacalai Tesque Inc.). Each bacterial strain was precultured with or without 5 µM c-di-AMP, and then 5 µL of the bacterial solution (OD570 = 1.0) was dropped onto the center of the LB medium [12]. After overnight culture, diameters of bacterial colonies were measured using the ImageJ software (National Institutes of Health).

Scanning electron microscopy

Bacteria were centrifuged (11000 × g, 3 min, 4 °C) and fixed overnight in 1% glutaraldehyde prepared in 0.1 M phosphate buffer (pH 7.4) at 4 °C or for 30 min at 25–28 ℃ and washed three times with 0.2 M cacodylate buffer for 10 min each. The cells were then fixed by incubation for 1 h in 1%OsO4 − 0.1 M Phosphate Buffer (pH 7.4) and subsequently dehydrated using a graded series of ethanol (50%, 70%, 90%, 95%, and 100%). The cells were then washed (15 min for each wash), and dried. After dehydration using a graded acetone series, E. coli cells were transferred to tert-butyl alcohol and frozen. Frozen E. coli cells were freeze-dried in a VFD-30 freeze-drying device (Vacuum Device Ltd., Ibaraki, Japan) and coated with osmium using a Neoc-Pro osmium coater (Meiwafosis Co., Ltd., Tokyo, Japan). The SEM images were obtained using a JSM-6510LV scanning electron microscope (JEOL, Tokyo, Japan) at 15 kV. The length of flagellin filaments was measured using the ImageJ software (National Institutes of Health).

Transmission electron microscopy

Bacteria were gently resuspended in TEM sample buffer with 1% glutaraldehyde in 0.1 M phosphate buffer (pH 7.4) overnight at 4 °C. A 10 μL sample was pipetted onto Formvar-coated 200-mesh nickel grids (Ted Pella Inc., Redding, CA, USA) and allowed to settle for 25 min. The grids were air-dried and observed under a JEM-1400 transmission electron microscope (JEOL) at 100 kV.

Liquid chromatography-tandem mass spectrometry analysis

After dispensing 200 μL of the extract in a 1.5 mL plastic tube, 50 μL of 10 μM 15N5-AMP (internal standard) aqueous solution and 1.0 mL of acetonitrile (ACN) were added. The mixture was centrifuged at 10,000 × g for 10 min at 4 °C. The supernatant was transferred to a new tube and dried under vacuum. The residue was dissolved in 100 μL of the solvent A (ACN/10 mM ammonium acetate in H2O = 1/9, v/v). Aliquots of the reconstituted solutions were mixed with H2O or 100 μM c-di-AMP in H2O (1/1, v/v) and filtered through a membrane filter (Millex-LG membrane, 0.45 µm, Millipore). The filtrate was used as a sample for LC–MS/MS. The samples were analyzed using a UPLC system (ACQUITY UPLC I-Class, Waters, Milford, MA, USA) and a triple quadrupole MS (Xevo TQ-S, Waters). A Scherzo SM-C18 MF column (3 µm, 150 mm × 2 mm i.d., Imtakt) was used for separation. The mobile phases A (ACN/10 mM ammonium acetate in H2O, 1/9, v/v) and B (ACN/100 mM ammonium acetate in H2O, 1/1, v/v) were used for gradient elution as follows: 0–40% B (0–8 min), 40–100% B (8–10 min), 100% B (10–11 min), 100–0% B (11–11.1 min), 0% B (11.1–15 min). The flow rate was set at 0.200 mL/min and the column temperature was maintained at 40 °C. The samples were maintained at 10 °C and 3 µL of each was injected into the column. The conditions for electrospray ionization and MS/MS were set as follows: ion mode, positive; capillary voltage, 3.0 kV; desolvation gas flow, 1000 L/h; cone gas flow, 150 L/h; nebulizer gas flow, 7.0 bar; source temperature, 150 °C; desolvation temperature, 500 °C; and data acquisition mode, MRM. The MRM transitions for c-di-AMP were set as follows: cone voltage, 60 V; precursor ion, m/z 658.7; collision energy, 50 eV; and product ion, m/z 136.1. MRM transitions for 15N5-AMP were set as follows: cone voltage, 30 V; precursor ion, m/z 353.1; collision energy, 20 eV; product ion, m/z 141.2. The data were analyzed using MassLynx V4.2. C-di-AMP sodium salt (SML-1231) and adenosine-15N5 5′-monophosphate (15N5-AMP) disodium salt (662658) were purchased from Merck KGaA (Darmstadt, Germany).

Statistical analysis

Data are presented as mean ± SD. The means of multiple groups were compared using analysis of variance (ANOVA), followed by Tukey’s tests using the JSTAT statistical software (version 8.2) and the unpaired Student’s t-test. All analyses were performed in a blinded manner without information about the experimental conditions. A value of P < 0.05 was considered significant. The animals were randomly assigned to various groups.

Availability of data and materials

All relevant data are within the manuscript and its supporting information.

Abbreviations

AIEC:

Adherent-invasive Escherichia coli

CD:

Crohn’s disease

c-di-AMP:

Cyclic di-AMP

CFU:

Colony-forming units

DMEM:

Dulbecco's modified Eagle medium

IBD:

Inflammatory bowel disease; LB: Luria Bertani

PCR:

Polymerase chain reaction

SEM:

Scanning electron microscopy

TEM:

Transmission electron microscopy

References

  1. Bernstein CN, Shanahan F. Disorders of a modern lifestyle: reconciling the epidemiology of inflammatory bowel diseases. Gut. 2008;57(9):1185–91. https://0-doi-org.brum.beds.ac.uk/10.1136/gut.2007.122143.

    Article  PubMed  Google Scholar 

  2. Molodecky NA, Soon IS, Rabi DM, et al. Increasing incidence and prevalence of the inflammatory bowel diseases with time, based on systematic review. Gastroenterology. 2012;142(1):46–542. https://0-doi-org.brum.beds.ac.uk/10.1053/j.gastro.2011.10.001.

    Article  PubMed  Google Scholar 

  3. Frank DN, St Amand AL, Feldman RA, et al. Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proc Natl Acad Sci U S A. 2007;104(34):13780–5. https://0-doi-org.brum.beds.ac.uk/10.1073/pnas.0706625104.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  4. Wiredu Ocansey DK, Hang S, Yuan X, et al. The diagnostic and prognostic potential of gut bacteria in inflammatory bowel disease. Gut Microbes. 2023;15(1):2176118. https://0-doi-org.brum.beds.ac.uk/10.1080/19490976.2023.2176118.

    Article  PubMed  PubMed Central  Google Scholar 

  5. Rolhion N, Darfeuille-Michaud A. Adherent-invasive Escherichia coli in inflammatory bowel disease. Inflamm Bowel Dis. 2007;13(10):1277–83. https://0-doi-org.brum.beds.ac.uk/10.1002/ibd.20176.

    Article  PubMed  Google Scholar 

  6. Barnich N, Carvalho FA, Glasser AL, et al. CEACAM6 acts as a receptor for adherent-invasive E. coli, supporting ileal mucosa colonization in Crohn disease. J Clin Invest. 2007;117(6):1566–74. https://0-doi-org.brum.beds.ac.uk/10.1172/JCI30504.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Rolhion N, Barnich N, Bringer MA, et al. Abnormally expressed ER stress response chaperone Gp96 in CD favours adherent-invasive Escherichia coli invasion. Gut. 2010;59(10):1355–62. https://0-doi-org.brum.beds.ac.uk/10.1136/gut.2010.207456.

    Article  CAS  PubMed  Google Scholar 

  8. Rolhion N, Hofman P, Darfeuille-Michaud A. The endoplasmic reticulum stress response chaperone: Gp96, a host receptor for Crohn disease-associated adherent-invasive Escherichia coli. Gut Microbes. 2011;2(2):115–9. https://0-doi-org.brum.beds.ac.uk/10.4161/gmic.2.2.15725.

    Article  PubMed  Google Scholar 

  9. Zheng L, Duan SL, Dai YC, et al. Role of adherent invasive. World J Clin Cases. 2022;10(32):11671–89. https://0-doi-org.brum.beds.ac.uk/10.12998/wjcc.v10.i32.11671.

    Article  PubMed  PubMed Central  Google Scholar 

  10. Fraser GM, Bennett JC, Hughes C. Substrate-specific binding of hook-associated proteins by FlgN and FliT, putative chaperones for flagellum assembly. Mol Microbiol. 1999;32(3):569–80. https://0-doi-org.brum.beds.ac.uk/10.1046/j.1365-2958.1999.01372.x.

    Article  CAS  PubMed  Google Scholar 

  11. Tanaka R, Imai J, Tsugawa H, et al. Adherent-invasive. Front Microbiol. 2023. https://0-doi-org.brum.beds.ac.uk/10.3389/fmicb.2023.1031997.

    Article  PubMed  PubMed Central  Google Scholar 

  12. Miki T, Hoshino Y, Sudo N, et al. Deletion and acetate reduce gut colonization of Crohn’s disease-associated adherent-invasive Escherichia coli by decreasing expression of type 1 fimbriae. Infect Immun. 2022;90(3):e0066221. https://0-doi-org.brum.beds.ac.uk/10.1128/iai.00662-21.

    Article  PubMed  Google Scholar 

  13. Barnich N, Boudeau J, Claret L, et al. Regulatory and functional co-operation of flagella and type 1 pili in adhesive and invasive abilities of AIEC strain LF82 isolated from a patient with Crohn’s disease. Mol Microbiol. 2003;48(3):781–94. https://0-doi-org.brum.beds.ac.uk/10.1046/j.1365-2958.2003.03468.x.

    Article  CAS  PubMed  Google Scholar 

  14. Kakkanat A, Phan MD, Lo AW, et al. Novel genes associated with enhanced motility of Escherichia coli ST131. PLoS ONE. 2017;12(5):e0176290. https://0-doi-org.brum.beds.ac.uk/10.1371/journal.pone.0176290.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. Corrigan RM, Abbott JC, Burhenne H, et al. c-di-AMP is a new second messenger in Staphylococcus aureus with a role in controlling cell size and envelope stress. PLoS Pathog. 2011;7(9):e1002217. https://0-doi-org.brum.beds.ac.uk/10.1371/journal.ppat.1002217.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Müller M, Hopfner KP, Witte G. c-di-AMP recognition by Staphylococcus aureus PstA. FEBS Lett. 2015;589(1):45–51. https://0-doi-org.brum.beds.ac.uk/10.1016/j.febslet.2014.11.022.

    Article  CAS  PubMed  Google Scholar 

  17. Oppenheimer-Shaanan Y, Wexselblatt E, Katzhendler J, et al. c-di-AMP reports DNA integrity during sporulation in Bacillus subtilis. EMBO Rep. 2011;12(6):594–601. https://0-doi-org.brum.beds.ac.uk/10.1038/embor.2011.77.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Woodward JJ, Iavarone AT, Portnoy DA. c-di-AMP secreted by intracellular Listeria monocytogenes activates a host type I interferon response. Science. 2010;328(5986):1703–5. https://0-doi-org.brum.beds.ac.uk/10.1126/science.1189801.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Corrigan RM, Gründling A. Cyclic di-AMP: another second messenger enters the fray. Nat Rev Microbiol. 2013;11(8):513–24. https://0-doi-org.brum.beds.ac.uk/10.1038/nrmicro3069.

    Article  CAS  PubMed  Google Scholar 

  20. Dempsey MJ. Marine bacterial fouling: a scanning electron microscope study. Marine Biol. 1981;61:305–15. https://0-doi-org.brum.beds.ac.uk/10.1007/BF00401570.

    Article  Google Scholar 

  21. Sanclement JA, Webster P, Thomas J, et al. Bacterial biofilms in surgical specimens of patients with chronic rhinosinusitis. Laryngoscope. 2005;115(4):578–82. https://0-doi-org.brum.beds.ac.uk/10.1097/01.mlg.0000161346.30752.18.

    Article  PubMed  Google Scholar 

  22. Hengge R, Pruteanu M, Stülke J, et al. Recent advances and perspectives in nucleotide second messenger signaling in bacteria. Microlife. 2023. https://0-doi-org.brum.beds.ac.uk/10.1093/femsml/uqad015.

    Article  PubMed  PubMed Central  Google Scholar 

  23. Sevrin G, Massier S, Chassaing B, et al. Adaptation of adherent-invasive. Gut Microbes. 2020;11(3):364–80. https://0-doi-org.brum.beds.ac.uk/10.1080/19490976.2017.1421886.

    Article  PubMed  Google Scholar 

  24. Pisani A, Rausch P, Bang C, et al. Dysbiosis in the gut microbiota in patients with inflammatory bowel disease during remission. Microbiol Spectr. 2022;10(3):e0061622. https://0-doi-org.brum.beds.ac.uk/10.1128/spectrum.00616-22.

    Article  CAS  PubMed  Google Scholar 

  25. Bivar XK. Bacterial interspecies quorum sensing in the mammalian gut microbiota. C R Biol. 2018;341(5):297–9. https://0-doi-org.brum.beds.ac.uk/10.1016/j.crvi.2018.03.006.

    Article  Google Scholar 

  26. Schmitt CK, Ikeda JS, Darnell SC, et al. Absence of all components of the flagellar export and synthesis machinery differentially alters virulence of Salmonella enterica serovar Typhimurium in models of typhoid fever, survival in macrophages, tissue culture invasiveness, and calf enterocolitis. Infect Immun. 2001;69(9):5619–25. https://0-doi-org.brum.beds.ac.uk/10.1128/IAI.69.9.5619-5625.2001.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  27. Darfeuille-Michaud A, Neut C, Barnich N, et al. Presence of adherent Escherichia coli strains in ileal mucosa of patients with Crohn’s disease. Gastroenterology. 1998;115(6):1405–13. https://0-doi-org.brum.beds.ac.uk/10.1016/s0016-5085(98)70019-8.

    Article  CAS  PubMed  Google Scholar 

  28. T E. Die Darmbakterien des Neugeborenen und Säuglings. Fortschr Med 1885;3(47–54):515–522.

  29. Méric G, Hitchings MD, Pascoe B, et al. From Escherich to the Escherichia coli genome. Lancet Infect Dis. 2016;16(6):634–6. https://0-doi-org.brum.beds.ac.uk/10.1016/S1473-3099(16)30066-4.

    Article  PubMed  Google Scholar 

  30. Macfarlane GT, Blackett KL, Nakayama T, et al. The gut microbiota in inflammatory bowel disease. Curr Pharm Des. 2009;15(13):1528–36. https://0-doi-org.brum.beds.ac.uk/10.2174/138161209788168146.

    Article  CAS  PubMed  Google Scholar 

  31. Manichanh C, Borruel N, Casellas F, et al. The gut microbiota in IBD. Nat Rev Gastroenterol Hepatol. 2012;9(10):599–608. https://0-doi-org.brum.beds.ac.uk/10.1038/nrgastro.2012.152.

    Article  CAS  PubMed  Google Scholar 

  32. Darfeuille-Michaud A. Adherent-invasive Escherichia coli: a putative new E. coli pathotype associated with Crohn’s disease. Int J Med Microbiol. 2002;292(3–4):185–93. https://0-doi-org.brum.beds.ac.uk/10.1078/1438-4221-00201.

    Article  CAS  PubMed  Google Scholar 

  33. Rasko DA, Rosovitz MJ, Myers GS, et al. The pangenome structure of Escherichia coli: comparative genomic analysis of E. coli commensal and pathogenic isolates. J Bacteriol. 2008;190(20):6881–93. https://0-doi-org.brum.beds.ac.uk/10.1128/JB.00619-08.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Imai J, Ichikawa H, Kitamoto S, et al. A potential pathogenic association between periodontal disease and Crohn’s disease. JCI Insight. 2021. https://0-doi-org.brum.beds.ac.uk/10.1172/jci.insight.148543.

    Article  PubMed  PubMed Central  Google Scholar 

  35. Tsugawa H, Ogawa A, Takehara S, et al. Primary structure and function of a cytotoxic outer-membrane protein (ComP) of Plesiomonas shigelloides. FEMS Microbiol Lett. 2008;281(1):10–6. https://0-doi-org.brum.beds.ac.uk/10.1111/j.1574-6968.2007.01041.x.

    Article  CAS  PubMed  Google Scholar 

  36. Imai J, Kitamoto S, Sugihara K, et al. Flagellin-mediated activation of IL-33-ST2 signaling by a pathobiont promotes intestinal fibrosis. Mucosal Immunol. 2019;12(3):632–43. https://0-doi-org.brum.beds.ac.uk/10.1038/s41385-019-0138-4.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

We are grateful to the Support Center for Medical Research and Education at Tokai University School of Medicine for their technical assistance.

Funding

This study was supported by a 2021 Tokai University School of Medicine Research Aid grant (210049) (to H.T.), Tokai University Research Organization Grant (21NS331825) (to H.T.), and Tokai University Supporters Association Research and Study Grant (23J00600) (to H.T.). Yakult Bio-Science Foundation (22J026000) (to J.I.), JSIBD Grants-in-Aid for IBD Research (22J029000) (to J.I.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Author information

Authors and Affiliations

  1. Department of Immunology, Division of Host Defense Mechanism, Tokai University School of Medicine, Isehara, Japan

    Rika Tanaka & Katsuto Hozumi

  2. Department of Clinical Health Science, Tokai University School of Medicine, Isehara, Japan

    Jin Imai

  3. Laboratory of Analytical and Bio-Analytical Chemistry, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka, Japan

    Eiji Sugiyama

  4. Transkingdom Signaling Research Unit, Division of Host Defense Mechanism, Tokai University School of Medicine, 143 Shimokasuya, Isehara, Kanagawa, 259-1193, Japan

    Shogo Tsubaki & Hitoshi Tsugawa

Authors
  1. Rika Tanaka
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Jin Imai
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Eiji Sugiyama
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Shogo Tsubaki
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Katsuto Hozumi
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Hitoshi Tsugawa
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

RT and HT contributed to the conception and design of the study. RT, ST, HT and ES performed the experiments. RT and HT organized the database and performed the statistical analysis. RT and HT wrote original draft of the manuscript. JI and HK reviewed and edited of the manuscript.

Corresponding author

Correspondence to Hitoshi Tsugawa.

Ethics declarations

Ethics approval and consent to participate

The study design was reviewed and approved by the Institutional Review Board of Tokai University School of Medicine (No. 20I-35) and was conducted according to principles of the Declaration of Helsinki. Written informed consent was obtained from all participants before their inclusion in the study.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1:

Figure S1. Construction of fliC-deleted non-AIEC K12 strain. Figure S2. Detection of c-di-AMP within in non-AIEC and AIEC.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Tanaka, R., Imai, J., Sugiyama, E. et al. Cyclic-di-AMP confers an invasive phenotype on Escherichia coli through elongation of flagellin filaments. Gut Pathog 16, 6 (2024). https://0-doi-org.brum.beds.ac.uk/10.1186/s13099-024-00600-4

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s13099-024-00600-4

Keywords

Gut Pathogens

ISSN: 1757-4749